La fidaxomicine inhibe la production de spores chez Clostridium difficile

La fidaxomicine inhibe la production de spores chez Clostridium difficile

Fidaxomicin FDX est un nouvel agent antimicrobien à activité bactéricide à spectre étroit et puissant contre Clostridium difficile Dans les essais cliniques récents, le FDX était supérieur à la vancomycine pour prévenir les récidives d’infection à C. Un mécanisme possible de réduction de la récidive pourrait être un effet inhibiteur. L’effet du FDX et de son principal métabolite OP- sur la croissance et la cinétique de sporulation de C difficile a été comparé à celui de la vancomycine, du métronidazole et de la rifaximine. Des sous-CMI ont été ajoutés aux cellules en début de croissance stationnaire; suivi de la collecte de cellules à divers intervalles pour quantifier le nombre total de cellules viables et de spores thermorésistantes sur les milieux contenant du taurocholate. L’effet des médicaments à – × MIC sur l’expression des gènes de sporulation chez le C difficile a également été comparé. réaction en chaîne par polymérase de la transcriptase inverse La FDX et la OP- / × MIC ont toutes deux inhibé la sporulation lorsqu’elles ont été ajoutées à des cellules en phase stationnaire précoces chez des souches de C difficile, y compris la souche épidémique NAP / BI / contrariant la vancomycine, le métronidazole et la rifaximine. Le nombre de spores après le traitement avec les médicaments de comparaison a augmenté au même niveau que le traitement sans contrôle médicamenteux. L’expression de gènes de sporulation spoIIID spécifiques à la cellule mère et à la spore a également été inhibée par FDX et OP- mais significativement par la vancomycine Contrairement à la vancomycine, à la rifaximine et au métronidazole, le FDX et l’OP inhibent efficacement la sporulation par le C difficile. l’effet inhibiteur du FDX sur la sporulation du C difficile peut contribuer à sa performance supérieure dans le maintien de la réponse clinique et la réduction des récurrences et peut également être bénéfique pour réduire l’excrétion et la transmission de ce pathogène

Clostridium difficile est une bactérie anaérobie sporulée qui est devenue une cause majeure de diarrhée infectieuse dans les établissements de santé et dans la communauté Plusieurs éclosions majeures ont eu lieu en Amérique du Nord et en Europe, dont une éclosion récente dans plusieurs hôpitaux de l’Ontario, Canada Bien que la production de toxines puissantes soit responsable des symptômes de la maladie, la formation d’endospores est également un facteur important de transmission et de récurrence des maladies. Les spores peuvent survivre, germer et proliférer dans l’intestin suite à un traitement antibiotique le microbiote intestinal Les spores dispersées dans les matières fécales sont extrêmement difficiles à éradiquer; ils peuvent persister dans les hôpitaux et les établissements de santé pendant de longues périodes, entraînant des infections nouvelles ou récidivantes Clostridium difficile a été traité principalement par la vancomycine, le métronidazole ou les deux, et ces médicaments sont disponibles depuis plusieurs années. ont des limites importantes Il est important de noter que les infections à C difficile se répètent chez environ% des patients traités par la vancomycine ou le métronidazole, et que certains patients présentent des récurrences multiples Fidaxomicin FDX est un nouvel agent antibactérien à spectre étroit récemment approuvé pour le traitement. traitement de la diarrhée associée au C difficile Dans des essais cliniques récents avec & gt; La fidaxomicine inhibe l’activité de l’ARN polymérase bactérienne à un stade très précoce de la transcription, en distinguant son mode d’action de ceux de la glaucomycine. d’autres inhibiteurs d’initiation de la transcription, comme les membres de la famille de la rifamycine Parce que FDX bloque la transcription génique plutôt que la synthèse cellulaire, la cible de la vancomycine et parce que le FDX n’agit pas par la production de radicaux libres. , il pourrait potentiellement inhiber l’expression des gènes liés à la sporulation Dans cette étude, nous avons examiné l’effet du FDX et de son principal métabolite OP- sur la cinétique de la sporulation et l’expression des gènes de sporulation.

Méthodes

Souches bactériennes

Clostridium difficile UK-, une analyse d’endonucléase de restriction REA BI BI souche isolée au cours d’une épidémie de C difficile en Angleterre Meridian Biosciences souche numéro SM-, a été aimablement fournie par le Dr Dale Gerding Strain UK-, un type d’électrophorèse en champ pulsé en Amérique du Nord La souche de ribotype PCR NAP / BI / polymérase de l’épidémie de Stoke-Mandeville Hospital a également été obtenue auprès du Dr Gerding Strain CD considéré comme étant l’ancêtre non pidémique le plus proche des souches a été obtenu auprès du Dr Michel Popoff. Les souches UK et ATCC ont été utilisées pour étudier l’effet des médicaments sur la cinétique de la sporulation. Les deux souches ont été conservées à – ° C dans du bouillon Brucella additionné d’hémine à μg / mL et de vitamine K à μg / mL SBB contenant% de glycérol Les isolats ont été repiqués sur% de plaques de gélose au sang dans des conditions anaérobies% d’azote,% de dioxyde de carbone et% d’hydrogène avant l’essai ingStrains UK et CD ont été utilisés pour étudier l’effet des médicaments sur l’expression des gènes de sporulation Ils ont été conservés à – ° C dans une infusion de coeur BHI contenant du glycérol% Les souches ont été isolées sur gélose BHI additionnée de% extrait de levure et% l -cysteine ​​BHIS Une seule colonie a été utilisée pour inoculer% bacto-tryptose,% extrait de levure, et% thioglycolate, pH TY moyen pour des cultures d’une nuit à ° C dans des conditions anaérobies

Agents antimicrobiens

La vancomycine, la rifaximine et le métronidazole, tous obtenus à partir de Sigma-Aldrich, ont été préparés sous la forme de solutions mères -mg / ml dans de l’eau, du méthanol et du diméthylsulfoxyde DMSO. Des concentrations similaires de FDX et OP- ont été préparées en dissolvant les composés dans du DMSO. ont été dilués à une concentration appropriée dans des milieux de croissance avant d’être utilisés pour la détermination de la concentration minimale inhibitrice et pour leurs effets sur la sporulation

Détermination MIC

Les concentrations inhibitrices minimales ont été déterminées dans des conditions adaptées aux conditions prévues de la sporulation et de l’expression de l’ARN messager ARNm La méthode de dilution microbienne plutôt que de dilution en gélose avec une légère modification a été utilisée pour la détermination MIC par rapport aux souches ATCC et UK Le sang lysé, qui obscurcit la couleur des milieux, a été omis des milieux de culture sans affecter la croissance de C difficile, de sorte que l’indicateur redox, la résazurine, pourrait être utilisé pour surveiller l’anaérobie de la chambre. équilibrée dans une boîte à gants anaérobie pendant un minimum d’heures. Des unités formant des colonies de Clostridium difficile [CFU] ont été ajoutées à chaque puits. Après une incubation de 10 heures à ° C, les plaques ont été examinées pour la croissance. pas de croissance ou la réduction la plus significative de la croissance a été observée pour déterminer les CMI pour les souches CD et UK-, Les souches de Clostridium difficile ont été cultivées à une densité optique à nm de la phase de croissance exponentielle, puis diluées pour donner un inoculum d’environ × CFU / mL en mL de milieu frais additionné d’une gamme de concentrations de Des cultures de FDX, d’OP ou de vancomycine ont été incubées dans des conditions anaérobies pendant des heures à ° C. La CMI a été définie comme la plus faible concentration d’antibiotique qui empêchait la turbidité visible après des heures.

Cinétique de croissance et de sporulation

Hardy Diagnostics a été mis en suspension dans des SBB à une DO d’approximativement. La suspension a été diluée davantage dans du SBB: et incubée à ° C dans une chambre anaérobie jusqu’à ce que les cellules atteignent un début stationnaire. phase de croissance environ heures pour la souche UK- et environ heures pour la souche ATCC Sub-MICs de médicaments ont ensuite été ajoutés aux cellules, et les cellules ont été surveillées pendant une période d’environ semaine. Des échantillons ont été prélevés à plusieurs reprises pour la quantification de la chaleur spores résistantes à l’incubation à ° C pendant minutes et au total des CFU en diluant en série chaque échantillon dans de l’eau pour les CFU de spores ou SBB pour les CFU totales et en plaquant chacune en double sur gélose BHIS additionnée de% de taurocholate

Analyse PCR quantitative de transcription inverse de l’expression d’un gène de sporulation

Des cultures nocturnes de C difficile cultivées en TY ont été utilisées pour inoculer du milieu TY frais à la DO d’environ FDX à × MIC ou OP- et de la vancomycine à × MIC ont été ajoutées aux cultures soit au début de la phase stationnaire T soit quelques heures après TT L’ARN a été préparé à partir de cellules bactériennes récoltées à T, T et heures après TT comme décrit précédemment L’ARN a été quantifié par absorbance à l’aide d’un spectrophotomètre NanoDrop ND Thermo Scientific Primers pour PCR quantitative qPCR ont été conçus en utilisant l’outil en ligne PrimerQuest Les technologies , et les efficacités d’amplification pour chaque ensemble d’amorces ont été déterminées avant utilisation. La synthèse de l’ADNc complémentaire a été réalisée sur ng d’ARN en utilisant des amorces hexamères aléatoires et le QuantiTect Reverse Transcription Kit QIAgen selon les recommandations du fabricant pour contrôler la contamination chromosomique de l’ADN, Des réactions de synthèse d’ADNc simulé ne contenant aucune transcriptase inverse ont été utilisées comme témoins négatifs Amplifications Des échantillons d’ADN complémentaires ont été dilués et utilisés comme gabarits pour qPCR des amorces rpoC oLB [CTAGCTGCTCCTATGTCTCACATC] et oLB [CCAGTCTCTCCTGGATCAACTA], s ribosomal ARN ribosomal ARNs oLB [GATTTACTTCGGTAAAGAGCGG] et oLB [CCTTACCAACTAGCTAATCAGACG], amorces spoIIR oLB [CTTCCAGCTGGTGAATATAAAGC] et oLB [CATAGTGGAGGGAACATAACACAC], et les amorces spOIIID oLB [GAGATCTCATATAGAGGAAAGGGC] et oLB [AACTTCTTTGGCAAGGGATG] en utilisant le mélange PCR Roche SYBR Green I et les réactions du thermocycleur Roche LightCycler II ont été réalisées dans un volume final de μL en utilisant μL d’ADNc dilué et d’amorces à -μM concentration finale L’amplification comprenait des cycles des étapes suivantes: secondes à ° C, secondes à ° C et secondes à ° C Les réactions ont été effectuées en triple en utilisant de l’ADNc synthétisé à partir de chacun d’un minimum de réplicats biologiques, et les résultats sont présentés comme erreur moyenne et les valeurs moyennes des données obtenues Les résultats ont été calculés à l’aide de la méthode -ΔΔCt , dans laquelle h la quantité d’ARNm cible est normalisée par rapport à celle d’un transcrit de contrôle interne rpoC ou s rRNA

RÉSULTATS

Pour garantir l’utilisation des niveaux de médicaments sous-MIC, qui ne conduiraient pas à une activité bactéricide au cours des études cinétiques, les CMI ont d’abord été déterminées à l’aide de la méthode de dilution microbrothique.

Tableau Concentrations minimales inhibitrices pour la fidaxomicine, l’OP-, la vancomycine, le métronidazole et la rifaximine CMI μg / mL Souches Clostridium difficile Fidaxomicine OP- Vancomycine Métronidazole Rifaximine ATCC ND ND UK- CD ND ND UK- ND ND CMI μg / mL Clostridium difficile Souche Fidaxomicine OP – Vancomycine Métronidazole Rifaximine ATCC ND ND Royaume-Uni ND ND UK- ND ND Abréviations: ATCC, American Type Culture Collection; MIC, concentration inhibitrice minimale; ND, non déterminéVoir grand

Effet des médicaments sur la cinétique de la croissance et de la sporulation

Pour isoler l’impact des médicaments sur la sporulation et éviter les effets inhibiteurs sur la croissance végétative, des études cinétiques ont été réalisées avec l’ajout de médicaments à une phase stationnaire précoce, lorsque la formation des spores commençait. La cinétique de sporulation variait considérablement entre les souches. et efficacement, avec des comptes de spores résistants à la chaleur aussi élevés que d’environ heures d’incubation et atteignant des UFC / ml d’environ heures. Figure En revanche, C difficile ATCC sporulé beaucoup moins efficacement, atteignant un maximum d’environ CFUs / ml. les deux souches ont également démontré une instabilité dans leur phénotype de sporulation; Dans certains cas, la souche ATCC n’a pas sporulé et le nombre de spores résistantes à la chaleur dans la souche UK n’a atteint que CFU / mL. Malgré l’activité inhibitrice du FDX dans toutes les expériences de sporulation, des essais expérimentaux dans lesquels les souches n’ont pas sporulé suffisamment n’ont pas été inclus dans les valeurs moyennes indiquées sur les figures

Figure Vue grandDownload slideDéveloppement des totaux viables des symboles remplis remplis de lignes pleines et de spores thermorésistants ouverts avec des lignes pointillées dans la souche Clostridium difficile UK: en l’absence de médicaments •, ○, en présence de fidaxomicin FDX ▴, Δ, in la présence de OP- ▾, ▿, et en présence de vancomycine ▪, □ Les données représentent les moyennes des courses indépendantes pour aucun contrôle de drogue, courses indépendantes pour FDX, courses indépendantes pour OP-, et courir pour la vancomycine Les barres d’erreur représentent le erreur type de la moyenne Abréviation: UFC, unités formant des coloniesFigure Vue largeTélécharger DiapositiveDéveloppement de totaux viables remplis de symboles avec des lignes pleines et des spores thermorésistantes symboles ouverts avec des lignes pointillées dans la souche Clostridium difficile UK: en l’absence de médicaments •, ○ , en présence de fidaxomicine FDX ▴, Δ, en présence de OP- ▾, ▿, et en présence de vancomycine ▪, □ Les données représentent les moyennes des essais indépendants pour aucune dr contrôle ug, essais indépendants pour FDX, essais indépendants pour OP-, et exécution pour vancomycine Les barres d’erreur représentent l’erreur standard de la moyenne Abréviation: UFC, unités formant des colonies

Figure Vue largeTélécharger la diapositiveDéveloppement du total des comptes viables remplis symboles avec des traits pleins et des spores résistants à la chaleur ouvrir des symboles avec des lignes pointillées dans Clostridium difficile American Type Culture Collection: en l’absence de médicaments •, ○, en présence de fidaxomicin FDX ▴, Δ , en présence de OP- ▾, ▿, et en présence de vancomycine ▪, □ Les données représentent les moyennes des séries indépendantes pour FDX, les séries indépendantes pour la vancomycine, et les séries indépendantes pour OP- Les barres d’erreur représentent l’erreur-type de la mean Abréviation: CFU, unités formant des coloniesFigure View largeTélécharger la diapositiveDéveloppement des totaux viables comtes remplis symboles avec des traits pleins et des spores thermorésistants ouverts symboles avec des lignes pointillées dans la souche Clostridium difficile American Type Culture Collection: en l’absence de médicaments •, ○, dans la présence de fidaxomicine FDX ▴, Δ, en présence de OP- ▾, ▿, et en présence de vancomycine ▪, □ Les données représentent l’avera ges d’essais indépendants pour FDX, essais indépendants pour la vancomycine, et essais indépendants pour OP- Les barres d’erreur représentent l’erreur standard de la moyenne Abréviation: CFU, unités formant des coloniesSuite à l’ajout de FDX ou OP- both à / × MIC à stationnaire- cellules en phase de souches C difficile ATCC et UK-, la production de spores a été arrêtée complètement Figures et bien que ni spores FDX pré-éliminées ni OP-, les deux ont empêché la production de spores supplémentaires Cette suppression était dépendante de la dose pour OP-; jours après l’exposition à OP- at / × MIC, le nombre de spores a augmenté par log et est resté à ce niveau qui était néanmoins log inférieur à celui du témoin non médicamenteux jusqu’à la fin de l’expérience, environ jours jours non indiqués Fidaxomicine À la différence de FDX et OP-, le médicament de comparaison vancomycine testé sur des sous-MIC similaires n’a eu aucun effet sur la sporulation chez les souches UK- ou ATCC. le nombre de spores après exposition à la vancomycine était très similaire à celui du témoin sans médicament pendant toute la durée des expériences même si le médicament était ajouté à la fin de la phase logarithmique des données de croissance non montrées. le métronidazole et la rifaximine ont également échoué à inhiber la formation de spores de la souche UK-; encore une fois, le nombre de spores a augmenté au même rythme que pour les cellules témoins qui n’ont été exposées à aucun médicament.

Figure Vue largeDownload slideDéveloppement des totaux viables des symboles remplis avec des lignes pleines et des spores résistants à la chaleur ouverts avec des lignes pointillées dans la souche Clostridium difficile UK: en l’absence de médicaments •, ○, en présence de métronidazole ▴, Δ, dans le présence de rifaximine ▾, ▿, et en présence de vancomycine ▪, □ Les données représentent des moyennes d’essais indépendants pour aucun médicament témoin, des essais indépendants pour le métronidazole, des essais indépendants pour la rifaximine et des analyses pour la vancomycine. la moyenne Abréviation: CFUs, unités formant des coloniesFigure View largeTélécharger la diapositiveDéveloppement des totaux viables des symboles remplis remplis de lignes pleines et de spores résistantes à la chaleur symboles ouverts avec des lignes pointillées dans la souche Clostridium difficile UK: en l’absence de médicaments •, ○, dans le présence de métronidazole ▴, Δ, en présence de rifaximine ▾, ▿, et en présence de vancomycine ▪, □ Les données représentent des moyennes d’indepe ndent ne fonctionne pas pour le médicament témoin, essais indépendants pour le métronidazole, essais indépendants pour la rifaximine et analyse pour la vancomycine Les barres d’erreur représentent l’erreur type de la moyenne Abréviation: UFC, unités formant des colonies

Effet des médicaments sur l’expression des gènes de la sporulation

Pour évaluer l’effet du traitement médicamenteux sur l’expression des gènes de sporulation, nous avons mesuré l’accumulation d’ARNm spécifiques de la sporulation dans des cellules traitées avec des médicaments au début de la phase stationnaire T dans les souches UK et CD As montrées dans le tableau, accumulation d’ARNm spoIIR , codant pour un produit génique spécifique de prepore précoce dépendant de σF, a augmenté substantiellement entre T et T en l’absence de médicaments dans les souches UK et CD Cette accumulation a été presque complètement empêchée par l’ajout de FDX μg / mL ou OP- μg / mL à T De même, l’accumulation d’ARNm de spoIIID, codant pour une protéine σE-dépendante spécifique au milieu de la mère, a été fortement inhibée par FDX et OP-ajouté au tableau T. Par contre, l’addition de vancomycine à T avait peu d’effet inhibiteur. sur l’accumulation ultérieure d’ARNm de spoIIR ou de spoIIID Tableau L’analyse statistique utilisant le test t de Student n’a pas démontré de différence entre la vancomycine et le groupe témoin P = pour les échantillons T et P = pour les échantillons T dans Tabl e En raison du faible contrôle de la taille de l’échantillon [n =] et de la vancomycine [n =] à T et de la vancomycine [n =] à T, la puissance était faible

Tableau Analyse de la réaction enzymatique de la polymérase de la transcriptase inverse quantitative de l’expression de spoIIR et de spoIIID après contrôle de la fidaxomicine, OP ou vancomycine Pas de médicaments, moyenne ± SD Fidaxomicine, moyenne ± SD OP-, moyenne ± SD vancomycine, moyenne ± écart-type UK- : rapport d’expression spoIIR / rpoC T – … … … T – – – – T – – – – Souche UK-: rapport d’expression spoIIID / rpoC T – … … … T – – – – T – – – – Déformation CD: rapport d’expression spoIIR / rpoC T – … … T – – – T – – – Strain CD: rapport d’expression spoIIID / rpoC T – … … T – – – T – – – Contrôle du temps pas de médicaments, Moyenne ± SD Fidaxomicine, Moyenne ± SD OP- , Moyenne ± SD vancomycine, Moyenne ± SD Souche UK-: rapport d’expression spoIIR / rpoC T – … … … T – – – – T – – – Souche UK-: rapport d’expression spoIIID / rpoC T – … … … T – – – – T – – – – Déformation CD: rapport d’expression spoIIR / rpoC T – … … T – – – T – – – Souche CD: Les souches de Clostridium difficile UK et CD ont été cultivées en% bacto-tryptose,% extrait de levure, et% thioglycolate, pH moyen jusqu’au début de la phase stationnaire T Chaque culture a ensuite été divisée en aliquotes qui n’ont reçu aucun médicament, fidaxomicine μg / mL, OP- μg / mL ou vancomycine μg / mL, comme indiqué. L’ARN a été récolté heures T et heures T après l’addition de médicaments, l’ADN complémentaire a été synthétisé amorces aléatoires, et réaction en chaîne par polymérase quantitative PCR a été réalisée en utilisant des amorces spécifiques du gène pour spoIIR ou spoIIID Résultats ont été normalisés à un gène de contrôle interne PoC et sont présentés comme le rapport de chaque niveau de transcription par rapport aux contrôles de type sauvage et non-médicament. La PCR quantitative a été faite en triple pour chaque échantillon. Les valeurs de déviation moyenne et moyenne reflètent les résultats d’au moins des réplicats biologiques. T échantillons après ajout de vancomycine avec souche UK- et les échantillons T simples pour OP- avec souche CDAbbreviation: SD, écart-type View LargeWhen FDX ou OP- a été ajouté aux cellules sporulantes de la souche CD à T, les niveaux des ARNm spoIIR et spoIIID non seulement Tableau Ce résultat suggère que la synthèse FDX et OP- des ARNm de sporulation, et que les ARNm sont instables et disparaissent en l’absence de synthèse continue. L’addition de vancomycine à T avait un effet relativement faible sur l’accumulation supplémentaire des ARNm de spoIIR et de spoIIID

Tableau Analyse quantitative de la réaction en chaîne de la polymérase inverse de la spoIIR et de la spoIIID après l’addition de médicaments au contrôle temporel T sans médicament, moyenne ± SD Fidaxomicine, moyenne ± SD OP-, moyenne ± SD vancomycine, moyenne ± écart-type CD: rapport d’expression spoIIR / s ARNt T – … … … T – … – … T – – – – CD de déformation: rapport d’expression spoIIID / s ARNt T – … … … T – … … … T – – – – Contrôle du temps pas de médicaments, moyenne ± SD Fidaxomicine , Moyenne ± SD OP-, moyenne ± SD vancomycine, moyenne ± SD Souche CD: rapport d’expression spoIIR / s ARNt T – … … … T – … … … T – – – – Souche CD: rapport d’expression spoIIID / s ARNr T – La souche CD de Clostridium difficile a été cultivée en% bacto-tryptose,% extrait de levure, et% thioglycolate, pH moyen au seco. nd heure T après le début de la phase stationnaire T A ce moment-là, la culture était divisée en aliquotes qui ne recevaient pas de médicament, fidaxomicine μg / mL, OP-μg / mL ou vancomycine μg / mL, comme indiqué. Quelques heures plus tard, à T, l’ADN complémentaire a été synthétisé, et la réaction en chaîne de la polymérase quantitative a été réalisée en utilisant des amorces spécifiques de gènes pour spoIIR ou spoIIID Les résultats ont été normalisés à un ARNs du contrôle interne et sont présentés comme chaque niveau de transcription par rapport aux contrôles de type sauvage et non-médicamenteux L’écart moyen et standard des valeurs moyennes reflète les résultats d’au moins des réplicats biologiques. Abréviation: écart-type, déviation standard.

DISCUSSION

Par conséquent, tout traitement qui conduit à l’inhibition de la formation de spores chez les patients atteints de CDI peut potentiellement réduire la transmission et la récidive de l’infection. Bien que les traitements standard avec la vancomycine soient efficaces Dans cette étude, nous rapportons que contrairement à la vancomycine ou au métronidazole, le FDX et son principal métabolite, l’OP-, sont très efficaces pour inhiber la formation de spores par le C difficile. , même dans les souches qui ont une efficacité de sporulation élevée Ces données supportent les résultats cliniques précédents de Louie et al , qui ont rapporté des taux de spores significativement plus faibles dans les échantillons de selles des sujets traités par FDX que dans ceux traités par vancomycine. la formation de CFU résistantes à la chaleur; les spores n’ont pas été quantifiées par microscopie L’analyse microscopique est apparue inutile pour la souche UK car en quelques jours, presque toutes les UFC étaient résistantes à la chaleur. Il y a eu des rapports contradictoires sur l’efficacité de sporulation de la souche ATCC. Burns et al , le nombre de spores résistantes à la chaleur que nous avons obtenues était faible aux heures et augmentait après les heures. Cependant, le titre maximal des spores était variable et n’atteignait en aucun cas le niveau des spores / mL rapportées par ce groupe. dans certains cas, le nombre de spores thermorésistantes produites par la souche ATCC était <& lt; CFU / mL Il est à noter que différents supports ont été utilisés dans les deux laboratoires; alors que Burns et al ont cultivé les souches dans BHIS, nous avons utilisé SBB et omis cystéine afin que nous puissions utiliser les surnageants pour les déterminations de titre de toxine dans une autre étude Alternativement, les écarts signalés pour les spores peuvent être dus à la présence de phénotypes mixtes. la souche et la sélection pour le phénotype avec une faible efficacité de sporulation dans nos conditions de laboratoire Ces phénotypes de sporulation mélangés, avec ségrégation de clones mutants qui ne sporulent pas efficacement, ont déjà été rapportés et peuvent expliquer les divergences entre les laboratoires. observé une instabilité phénotypique similaire avec la souche UK- dans certains essais Ces observations sont en faveur d'une meilleure conception expérimentale, comme indiqué précédemment , pour assurer la reproductibilité des compétences de sporulation dans le C difficileOur les données indiquent que lorsque FDX et OP- sont sous-MIC ajouté aux cellules C difficile au début de la phase stationnaire, la viabilité cellulaire n'est pas affectée, mais t Le processus de sporulation est arrêté En outre, nous avons démontré qu'un tel arrêt peut être attribué à une puissante inhibition de la transcription d'au moins certains et probablement de tous les gènes de sporulation. La fidaxomicine et l'OP bloquent même l'accumulation d'ARNm qui ont commencé à s'accumuler. , FDX ou OP- peuvent empêcher l'achèvement du processus de sporulation dans la majorité des cellules, même lorsqu'elles sont ajoutées après le début du processus. En revanche, la vancomycine et le métronidazole sont inefficaces pour bloquer la sporulation lorsqu'ils sont ajoutés aux cellules en phase stationnaire. Bien que, dans certains cas, le rapport d'expression moyen dans le bras traité par la vancomycine ait été réduit par rapport au témoin, cette différence n'a pas semblé significative, comme l'indiquent les intervalles de chevauchement les groupes traités par la vancomycine et les groupes témoins. Ces résultats correspondent aux mécanismes d'action de la La vancomycine inhibe la transcription, un processus qui doit se produire continuellement pendant la croissance et la sporulation pour produire des spores. La vancomycine et le métronidazole inhibent les processus spécifiques aux cellules en croissance. Leur incapacité à bloquer la sporulation dans les cellules en phase stationnaire pourrait donc Le but de la rifaximine, comme pour le FDX et l'OP-, est l'ARN polymérase bactérienne. L'ajout de rifaximine aux cellules en phase stationnaire n'a eu aucun effet sur la formation ultérieure de spores la rifaximine peut avoir des effets sélectifs sur les différentes formes d'ARN polymérase qui sont actives dans les cellules en croissance et sporulantes. Il est intéressant de noter que Hawirko et al ont découvert que la drogue n'est pas absorbée par les cellules en phase stationnaire. La rifampicine était plus efficace pour bloquer la sporulation de Clostridium botulinum lorsqu'elle était ajoutée pendant la croissance exponentielle En résumé, les résultats présentés ici montrent que le FDX et l'OP- sont de puissants inhibiteurs de la formation de spores du C difficile et sont efficaces même après l'ajout du processus de différenciation. Cette propriété peut contribuer à une plus grande efficacité du FDX par rapport à la vancomycine chez les réduire la récidive de CDI

Remarques

Supplément de parrainage Cet article a été publié dans le cadre d’un supplément intitulé «Fidaxomicine et l’approche évolutive du traitement de l’infection Clostridium difficile», parrainé par Optimer Pharmaceuticals, IncPotential conflits d’intérêts FB, AG, PS et LN sont des employés d’Optimer Pharmaceuticals, Inc LB et ALS ont reçu une subvention d’Optimer Pharmaceuticals, Inc et sont employés de l’école de médecine de l’Université TuftsTous les auteurs ont soumis le formulaire ICMJE pour la divulgation des conflits d’intérêts potentiels Conflits que les éditeurs jugent pertinents pour le contenu du manuscrit ont été divulgués

Sylvie

Les commentaires sont fermés.