Relation entre le polymorphisme du récepteur du type péage et la maladie du cytomégalovirus après la transplantation hépatique

Relation entre le polymorphisme du récepteur du type péage et la maladie du cytomégalovirus après la transplantation hépatique

Les données expérimentales suggèrent que le cytomégalovirus CMV initie l’immunité innée par l’activation du récepteur Toll-like TLR Pour évaluer la pertinence clinique de cette observation expérimentale, nous avons évalué l’association entre le polymorphisme mononucléotidique spécifique qui entraîne la substitution de l’arginine par la glutamine. Méthodologie du TLR ArgGln et réplication du CMV et maladie après transplantation hépatiqueMéthodesNinety-deux receveurs de greffe du foie atteints d’hépatite chronique C ont été sélectionnés pour la présence du polymorphisme TLG ArgGln. La charge CMV a été déterminée dans des échantillons sanguins prélevés en série à l’aide de l’ADN polymérase du CMV. Estimation Le degré de réplication CMV, tel que mesuré par la charge CMV, était significativement plus élevé chez les patients qui étaient homozygotes charge virale maximale moyenne, copies / mL et hétérozygote moyenne maximale charge virale, copies / mL pour ce polymorphisme, comparé aux patients sans le polymorphisme TLR ArgGln signifie la charge virale maximale, copies / mL; P = Une analyse de survie de Kaplan-Meier a démontré une association entre être homozygote pour le polymorphisme TLR ArgGln et maladie CMV P = Un modèle de risque proportionnel multivarié de Cox a démontré une tendance vers un risque plus élevé de maladie à CMV chez les patients homozygotes pour le polymorphisme TLR ArgGln ratio, [% intervalle de confiance, -]; P = après ajustement pour l’âge du patient, le statut sérologique CMV, et le rejet de l’allogreffeConclusionsTLR Le polymorphisme ArgGln est possiblement associé à la réplication du CMV et à la maladie après transplantation hépatique Cette nouvelle observation clinique confirme le rôle potentiel du TLR dans le contrôle immunologique de l’infection à CMV chez l’homme

La découverte des TLR des récepteurs de type Toll a permis de mieux comprendre les mécanismes moléculaires de reconnaissance des pathogènes et d’immunité innée contre les agents infectieux La stimulation des TLR par des modèles moléculaires pathogènes active les voies de signalisation intracellulaires et conduit à l’induction de gènes antimicrobiens cytokines inflammatoires, qui aident à contrôler les stades précoces de l’infection jusqu’à l’établissement du bras adaptatif pathogène spécifique de la réponse immunitaire Actuellement, les molécules TLR ont été décrites chez l’homme Ces récepteurs reconnaissent les ligands spécifiques qui vont du lipopolysaccharide LPS dans les bactéries gram-négatives, le peptidoglycane et l’acide lipotéichoïque dans les bactéries gram-positives, la flagelline bactérienne, l’ADN CpG, les acides nucléiques viraux et les composants des mycobactéries, levures, agents pathogènes viraux et parasitaires La capacité des TLR à signaler la présence d’envahir les pathogènes dans le milieu interne et orchestrer une réponse immunitaire caractérisent leur rôle dans la pathogenèse des maladies infectieuses Les données expérimentales ont démontré que les souris déficientes en TLR ont une capacité réduite à répondre aux LPS Chez l’homme, la présence de mutations faux-sens qui affectent le domaine extracellulaire une réponse immunitaire émoussée au LPS inhalé et prédispose un individu à une bronchiolite sévère liée au virus syncitial respiratoire De même, les souris déficientes en TLR sont très sensibles aux infections à Staphylococcus aureus – une observation qui concorde avec un risque plus élevé de staphylococcie Résumé: Des observations expérimentales récentes indiquent que les TLR participent à l’immunité innée contre l’infection par le CMV dans des expériences in vitro utilisant des anticorps murins et murins contre des infections à cytomégalovirus CMV chez l’homme. cellules humaines, la stimulation du TLR par le CMV entraîne la translocation de Cependant, la pertinence clinique de ces observations expérimentales n’a pas été étudiée. Nous émettons l’hypothèse que si le TLR participe au contrôle de l’infection par le CMV par la libération de cytokines antivirales et la régulation de l’immunité adaptative. , la présence de polymorphismes fonctionnels dans TLR entraverait cette réponse immunitaire et entraînerait cliniquement des niveaux plus élevés de réplication du CMV et de maladie à CMV symptomatique Nous avons testé ce concept en utilisant le modèle humain de transplantation hépatique – une situation clinique caractérisée par la présence fréquente d’infections à CMV et En particulier, nous avons comparé l’apparition de la maladie CMV chez des patients avec ou sans un polymorphisme mononucléotidique spécifique qui entraîne la substitution de l’arginine pour la glutamine en position TLR. Le polymorphisme TLR ArgGln Ce polymorphisme spécifique est intéressant car il est le plus mutation fréquemment signalée dans TLR , et sa présence a été décrite résulter en un défaut fonctionnel à la stimulation avec le lipopeptide bactérien prototypique TLR ligand Comme nos données suggèrent, ce polymorphisme mononucléotidique spécifique dans TLR est potentiellement associé à la réplication du CMV et à la maladie après la transplantation du foie

Patients et méthodes

Population étudiée et prélèvements sanguins La population étudiée était constituée d’une cohorte de patients consécutifs ayant subi une transplantation hépatique pour hépatite C chronique au cours de la période – Cette cohorte a été choisie uniquement sur la base des prélèvements sanguins disponibles pour les tests. Les échantillons sanguins périphériques obtenus à partir de ces patients ont été conservés à-° C avant cette étude. L’étude a été approuvée par l’Institutional Review Board de la Fondation Mayo de Rochester, MN. Résultats de l’étude suivi clinique Le résultat d’intérêt pour cette étude était la maladie à CMV et la charge virale. La CMV était définie comme la présence de signes cliniques et de symptômes compatibles avec le diagnostic accompagnés de l’isolement du CMV à partir d’échantillons de sang ou de tissus. tous les patients ont été examinés pour les caractéristiques démographiques et cliniques , traitement immunosuppresseur, rejet aigu d’allogreffe et statut sérologique du CMV chez le donneur et le receveur Les schémas thérapeutiques immunosuppresseurs des patients variaient avec le temps et, selon la période de transplantation, consistaient en cyclosporine, azathioprine et prednisone de à; le tacrolimus, la prednisone et le mycophénolate mofétil ou l’azathioprine; et tacrolimus, mycophénolate mofétil, et prednisone de à Tous les patients ont été observés jusqu’à la maladie de CMV ou la mort, ou jusqu’à un maximum d’années après avoir subi une greffe du foieAssessment of CMV replicationSerum échantillons qui ont été recueillis chaque semaine pendant les premières semaines et mois L’ADN génomique a été extrait de μL de sérum à l’aide du kit d’extraction d’acide nucléique IsoQuick ORCA Research selon les recommandations du fabricant Tous les échantillons ont été soumis à une quantification d’ADN CMV par PCR en temps réel en utilisant le LightCycler Comme tous les patients avaient une charge indétectable de CMV au moment de la transplantation, toute détection ultérieure de l’ADN du CMV était indicative de la réplication du CMV. Détection du polymorphisme TLRPour effectuer l’extraction des acides nucléiques, des échantillons de sang périphérique sang ou PBMC ont été soumis t o extraction d’acide nucléique utilisant la méthode Isoquick Nucleic Acid ORCA Research, selon les instructions du fabricant L’acide nucléique extrait a été élué dans des ul de l’ADNase stérile et de l’eau sans ARNase. 5 μL de l’ADN élué ont été utilisés pour détecter le polymorphisme TLR. Les résultats de la PCR ont été confirmés par séquençage de gènes d’échantillons représentatifsPour détecter le polymorphisme TLR ArgGln, μL d’ADN extrait a été mélangé avec μL de PCR solution constituée de mélange maître LightCycler FastStart Roche Molecular Biochemicals, μmol / L de chaque amorce sens primaire «-AGTGAGCGGGATGCCTACT-» et antisens «-GACTTTATCGCACTCTCAGATTTAC-», mmol / L chlorure de magnésium, μL eau, μmol / L sonde TLR ‘- CAAGCTGCAGAAGATAATGAACACCAAG -‘-FL, et μmol / L TLR ancre sonde LC Rouge -‘- CCTACCTGGAGTGGCCCATGGACG- ‘dénaturation initiale était p formé à ° C pendant min, suivi par des cycles de dénaturation ° C pendant sec, ° C par seconde, recuit ° C pendant sec, et extension ° C pendant sec. Analyse de la courbe de fusion en cycle à ° C pendant sec et ° C pendant sec, Pour l’analyse de la courbe de fusion, le TLR de type sauvage avait un pic de fusion de ° C, alors que le polymorphisme mononucléotidique qui a abouti à la substitution ArgGln avait un pic de fusion. de ° Analyse statistique L’analyse des données a été réalisée en utilisant des statistiques descriptives, y compris moyenne, médiane, SD,% CI, et plage. La comparaison des proportions a été réalisée en utilisant le test exact de Fisher L’estimation de Kaplan-Meier a été utilisée pour décrire la courbe de survie. Des modèles ont été utilisés pour évaluer les associations entre les covariables et la maladie à CMV. Pour décrire la relation entre le polymorphisme TLR et la réplication du CMV, la charge virale maximale a été obtenue pour chaque patient et a comparé chez les patients avec ou sans polymorphisme TLR en utilisant l’analyse de la variance La signification statistique a été fixée à P ⩽

Résultats

La population étudiée était composée de patients ayant subi une transplantation hépatique pour une hépatite C chronique. L’âge ± SD moyen des patients était de ± ans. La majorité des patients étaient des hommes Le principal critère de jugement était chez les patients. SD, ± jours après la transplantationTous les patients ont été testés pour le polymorphisme TLR ArgGln , qui a abouti à un récepteur fonctionnellement défectueux Parmi les patients,% avaient au moins un allèle qui avait le polymorphisme TLR ArgGln; Les patients étaient% hétérozygotes et% étaient homozygotes pour ce polymorphisme. Le polymorphisme du TLR est associé à la maladie de CMVHomozygosité, mais pas hétérozygotie, car le polymorphisme TLR ArgGln était associé à la maladie CMV La maladie CMV est survenue chez% des patients homozygotes pour le polymorphisme TLR ArgGln, en % de patients hétérozygotes pour le polymorphisme TLR ArgGln, et% de patients n’ayant pas le polymorphisme TLR ArgGln L’analyse de survie utilisant l’estimation de Kaplan Meier a démontré une association possible entre la maladie CMV et l’homozygotie mais pas l’hétérozygotie pour le polymorphisme TLR ArgGln P = , par le chiffre du test du log-rank

Figure Vue largeDownloadKaplan-Meier estimation de cytomégalovirus CMV survie sans maladie chez les receveurs de greffe du foie avec homozygotie ou hétérozygotie pour le polymorphisme mononucléotidique spécifique qui entraîne la substitution de l’arginine pour la glutamine en position du récepteur Toll-like le polymorphisme TLR ArgGln, EstimationKaplan-Meier de la survie sans CMV du cytomégalovirus CMV chez les receveurs de greffe de foie avec homozygotie ou hétérozygotie pour le polymorphisme mononucléotidique spécifique qui entraîne la substitution de l’arginine pour la glutamine en position de récepteur Toll-like le polymorphisme TLR ArgGln, comparé aux homozygotes de type sauvage Dans un modèle de risque proportionnel de Cox univariable, une tendance a été observée entre l’homozygotie pour le polymorphisme TLR ArgGln et le rapport de risque de maladie à CMV, [% CI, -]; P = Dans ce modèle, la maladie à CMV était significativement plus fréquente chez les patients ayant présenté un risque aigu de risque de rejet d’allogreffe [RR], [% IC, -]; P =; les patients qui ont reçu des bolus stéroïdiens pour le traitement du rejet aigu de l’allogreffe; RR, [% CI, -]; P =; et les patients séronégatifs pour le CMV qui ont reçu des allogreffes de foie provenant de donneurs séropositifs pour le CMV RR: [% CI, -]; P = Une tendance non significative vers un risque plus élevé de maladie à CMV a été observée avec l’âge du patient RR, [% IC, -]; P = Aucun des médicaments immunosuppresseurs n’était significativement associé à un risque accru de maladie à CMV, y compris l’azathioprine, le mycophénolate mofétil et la prednisone L’utilisation de la cyclosporine, qui impliquait% des patients, entraînait une tendance à l’association RR CMV, [% CI, -]; P =, alors que l’utilisation du tacrolimus, qui impliquait un pourcentage de patients, était associée à un risque plus faible de maladie à CMV RR, [% IC, -]; P = Dans le modèle de risque proportionnel Cox multivariable subséquent, en utilisant une approche par étapes tenant compte de l’âge du patient, du rejet aigu de l’allogreffe et du statut de mésappariement CMV, il y avait une association marginale entre l’homozygotie pour le polymorphisme TLR ArgGln et la maladie du CMV. , -]; P = tableau Aucun changement significatif dans l’association possible n’a été observé lorsque l’utilisation de la cyclosporine ou du tacrolimus a été incluse dans les données du modèle statistique non montrées.

Tableau View largeTéléchargerMultivariate Cox modèle de risque proportionnel évaluant les associations entre rejet aigu d’allogreffe, statut de mésapport cytomégalovirus CMV, âge du patient et homozygotie pour le polymorphisme mononucléotidique spécifique qui entraîne la substitution de l’arginine pour la glutamine en position de récepteur Toll-like. Le modèle de risque proportionnel de Cox évaluant les associations entre le rejet aigu d’allogreffe, l’état de mésappariement de cytomégalovirus CMV, l’âge de patient, et l’homozygotie pour le polymorphisme mononucléotidique spécifique qui a comme conséquence la substitution d’arginine pour le polymorphisme de TLV ArgGln. glutamine en position de récepteur Toll-like le polymorphisme TLR ArgGln, avec le résultat du polymorphisme CMV diseaseTLR est associée à la réplication CMVPour examiner plus loin l’association entre TLR et CMV, nous avons corrélé le polymorphisme TLR ArgGln avec le degré d’ADNmc CMV Comme indiqué i Tableau n, la présence du polymorphisme TLG ArgGln était significativement associée à des taux plus élevés d’ADN du CMV dans le sang périphérique. La charge maximale moyenne en ADN du CMV était significativement plus élevée chez les patients homozygotes / mL [% CI,, -, copies / mL ] et hétérozygotes, copies / mL [% CI, -, copies / mL] pour le polymorphisme TLR ArgGln, comparé à ceux sans les copies de polymorphisme / mL [% CI, – copies / mL]; P = Parmi le sous-groupe de patients ayant développé une maladie à CMV, la charge maximale de CMV était significativement plus élevée chez les patients homozygotes, copies / ml [% CI,, -, copies / mL] et hétérozygotes, copies / mL [% CI,, -, copies / mL] pour le polymorphisme, comparé à ceux qui n’avaient pas le polymorphisme, copies / mL [% CI, -, copies / mL]; P =

Tableau View largeTélécharger la lameCréer les taux maximaux de cytomégalovirus CMV chez les patients avec ou sans le polymorphisme mononucléotidique spécifique qui entraîne la substitution de l’arginine pour la glutamine en position de récepteur Toll-like. TLR ArgGln polymorphismeTable View largeTélécharger les taux de cytomégalovirus maximum CMV chez les patients avec ou sans le polymorphisme mononucléotidique spécifique qui entraîne la substitution de l’arginine pour la glutamine en position de récepteur Toll-like le polymorphisme TLR ArgGln

Discussion

Les transplantés du foie avec un polymorphisme TLR ArgGln à un seul nucléotide dans au moins l’allèle présentaient des taux significativement plus élevés de réplication du CMV, tels que mesurés par la charge virale du CMV. De plus, les patients présentant une homozygotie Ces nouvelles observations concordent avec les données expérimentales in vitro sur l’interaction TLR-CMV. Ces observations fournissent donc un aperçu de la pathogenèse de l’infection par le CMV en suggérant un rôle potentiel du TLR dans le contrôle immunologique. L’implication du TLR dans la réponse immunitaire contre le CMV chez l’homme a été initialement suggérée par un modèle expérimental in vitro Les cellules qui manquaient d’expression TLR ne sécrétaient pas de cytokines pendant la stimulation avec un CMV ou des antigènes CMV cellules déficientes ont été manipulées expérimentalement pour exprimer le TLR humain in vitro et ont ensuite été imulé avec CMV, les cellules ont acquis une réactivité, qui se manifeste par la sécrétion de cytokines pro-inflammatoires Récemment, il a également été suggéré que ceci est dû à la reconnaissance de la glycoprotéine B de l’enveloppe virale par TLR entre un polymorphisme fonctionnel dans la réplication des TLR et CMV et des supports de maladie – et apporte potentiellement une pertinence clinique à ces observations expérimentales Plus important, du point de vue de la pathogenèse, nos observations impliquent probablement que le premier stade de la rencontre entre l’hôte et les cellules immunitaires innées par la détection de TLR et le pathogène c.-à-d. CMV doit être partie intégrante du contrôle optimal de ce pathogène. Le polymorphisme nucléotidique simple qui a abouti à la mutation ArgGln dans TLR a été montré pour aboutir à un récepteur fonctionnellement défectueux, au moins contre les lipopeptides bactériens. étude, les cellules qui ont été transfectées avec un polymorphisme TLR ArgGln n’ont pas En effet, cette mutation particulière a été significativement associée à une prédisposition plus élevée au développement de la septicémie bactérienne La présente étude concorde avec ces observations cliniques en démontrant la relation entre l’homozygotie pour le polymorphisme TLR ArgGln et la réplication du CMV. et maladie clinique En conséquence, nous supposons que le défaut fonctionnel dans le mutant TLR peut avoir empêché la réponse immunitaire innée contre CMV un ligand TLR, entraînant ainsi une maladie symptomatique intéressant, notre étude implique en outre que la présence d’un seul allèle fonctionnel de type sauvage Les patients qui étaient hétérozygotes pour le polymorphisme TLR ArgGln se sont comportés de façon phénotypique identique à ceux sans polymorphisme, c’est-à-dire que les patients n’avaient pas un risque significativement plus élevé de maladie à CMV que les homozygotes de type sauvage. l’observation clinique concorde avec l’expérience Des données montrent la capacité des cellules obtenues à partir d’individus avec hétérozygotie à répondre au polymorphisme TLR ArgGln lorsqu’elles sont stimulées par un ligand TLR. Cependant, nos données cliniques suggèrent également que la réponse immunitaire contre le CMV chez les patients avec hétérozygotie pour le polymorphisme TLR ArgGln peut Les implications cliniques potentielles de nos observations devraient encourager le développement de plus d’études pour confirmer nos résultats. Nous reconnaissons et soulignons que nos conclusions sont limitées par le nombre relativement faible de patients et de patients. associations statistiques marginales observées En outre, notre population étudiée était homogène, composée uniquement de receveurs de greffe du foie et d’hépatite C chronique sous-jacente. Par conséquent, nos résultats peuvent uniquement s’appliquer aux receveurs de greffe de foie infectés par le virus de l’hépatite C exécuté confirmer nos observations chez les transplantés hépatiques non atteints d’hépatite C chronique, chez d’autres receveurs de greffe de cellules souches hématopoïétiques et chez des transplantés de cellules souches hématopoïétiques et chez des patients immunodéprimés non greffés, tels que ceux atteints de SIDA et de nouveau-nés infectés par CMV congénitale. Notre étude a montré que les patients présentant une homozygotie pour le polymorphisme TLR avaient des niveaux plus élevés de réplication du CMV et de la maladie clinique CMV. D’autre part, les patients présentant une hétérozygotie pour le polymorphisme ne sont pas À notre connaissance, ces observations fournissent des preuves cliniques qui appuient probablement le rôle du TLR dans la pathogenèse de la maladie à CMV chez l’homme. En raison des implications cliniques potentielles, nous avons un risque accru de CMV. encourager le développement de nouvelles études pour confirmer notre observation ations

Remerciements

Nous remercions Ross Dierkhising pour l’analyse statistique et la consultation et Teresa Hoff pour la préparation des manuscrits. Soutien financierDepartment of Medicine et le prix Transplant Centre Scholarly par le Centre de transplantation William J. von Liebig, Mayo Clinic, Rochester, MN à RRRPotentiel de conflits d’intérêts Tous les auteurs: aucun conflit

Sylvie

Les commentaires sont fermés.